Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPBC-LG6s
(Plasmid #62809)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62809 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSP72
  • Backbone manufacturer
    Promega Corporation
  • Backbone size w/o insert (bp) 2462
  • Total vector size (bp) 7117
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITR-CAG-Lck-GCaMP6s-ITR
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer ATACGACAATCTCACAGACAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6s was obtained from pGP-CMV-GCaMP6s (Addgene Plasmid #40753). Lck was obtained from pN1-Lck-GCaMP2 (Addgene Plasmid #24794).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPBC-LG6s was a gift from Karen Wilcox (Addgene plasmid # 62809 ; http://n2t.net/addgene:62809 ; RRID:Addgene_62809)
  • For your References section:

    Imaging activity in astrocytes and neurons with genetically encoded calcium indicators following in utero electroporation. Gee JM, Gibbons MB, Taheri M, Palumbos S, Morris SC, Smeal RM, Flynn KF, Economo MN, Cizek CG, Capecchi MR, Tvrdik P, Wilcox KS, White JA. Front Mol Neurosci. 2015 Apr 15;8:10. doi: 10.3389/fnmol.2015.00010. eCollection 2015. 10.3389/fnmol.2015.00010 PubMed 25926768