-
PurposeMiddle Entry clone for Gateway containing a zebrafish codon-optimized Cas9 flanked by 2 NLS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63154 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepME-MCS (Tol2Kit #237)
- Backbone size w/o insert (bp) 2765
- Total vector size (bp) 6907
-
Vector typeCRISPR ; Tol2 Middle Entry vector for Gateway
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)4199
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CCTACTCAGGAGAGCGTTCA
- 3′ sequencing primer CAGGAAACAGCTATGACCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made bythe Chen laboratory (Jao et al., PNAS 2013).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference for zebrafish codon-optimized Cas9:
Jao, L.E., Wente, S.R., and Chen, W. (2013). Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A 110, 13904-13909.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME-Cas9 was a gift from Leonard Zon (Addgene plasmid # 63154 ; http://n2t.net/addgene:63154 ; RRID:Addgene_63154) -
For your References section:
A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish. Ablain J, Durand EM, Yang S, Zhou Y, Zon LI. Dev Cell. 2015 Mar 4. pii: S1534-5807(15)00075-1. doi: 10.1016/j.devcel.2015.01.032. 10.1016/j.devcel.2015.01.032 PubMed 25752963