Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #63154)


Item Catalog # Description Quantity Price (USD)
Plasmid 63154 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pME-MCS (Tol2Kit #237)
  • Backbone size w/o insert (bp) 2765
  • Total vector size (bp) 6907
  • Vector type
    CRISPR ; Tol2 Middle Entry vector for Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCTACTCAGGAGAGCGTTCA
  • 3′ sequencing primer CAGGAAACAGCTATGACCAT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Reference for zebrafish codon-optimized Cas9:
Jao, L.E., Wente, S.R., and Chen, W. (2013). Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A 110, 13904-13909.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME-Cas9 was a gift from Leonard Zon (Addgene plasmid # 63154 ; ; RRID:Addgene_63154)
  • For your References section:

    A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish. Ablain J, Durand EM, Yang S, Zhou Y, Zon LI. Dev Cell. 2015 Mar 4. pii: S1534-5807(15)00075-1. doi: 10.1016/j.devcel.2015.01.032. 10.1016/j.devcel.2015.01.032 PubMed 25752963