pDual-eGFP(Y203)
(Plasmid
#63559)
-
PurposeExpression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63559 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDual-eGFP
- Backbone size w/o insert (bp) 10680
- Total vector size (bp) 10947
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionseGFP is strongly expressed in the Rosetta-gami™2(DE3) strain (EMD Millipore) following IPTG induction of the T7 RNA polymerase gene.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHis-T7-eGFP(Y203)
-
Alt nameHis-tagged, T7-tagged Mostaza (yellow) variant of enhanced green fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)864
-
MutationChanged threonine at position 203 with respect to the original eGFP sequence to tyrosine. The DNA sequence change corresponds to AC at nucleotide 727-728 to TA.
-
GenBank IDKM019175
- Promoter CMV-EF1α hybrid (CEF)
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- T7 (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgtcgccgtccagctcgaccag
- 3′ sequencing primer gagcaagggcgaggagctgttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDual-eGFP(Y203) was a gift from Richard S Myers (Addgene plasmid # 63559 ; http://n2t.net/addgene:63559 ; RRID:Addgene_63559) -
For your References section:
Fluorescent protein engineering by in vivo site-directed mutagenesis. Valledor M, Hu Q, Schiller P, Myers RS. IUBMB Life. 2012 Aug;64(8):684-9. doi: 10.1002/iub.1041. Epub 2012 May 28. 10.1002/iub.1041 PubMed 22639380