-
PurposeExpression of eGFP in bacteria and in mammalian cells. Used as a reporter for quantifying gene targeting and recombineering in mammalian cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNL-eGFP/CEF
-
Backbone manufacturerJakob Reiser
- Backbone size w/o insert (bp) 10680
- Total vector size (bp) 10947
-
Modifications to backboneA PCR product amplified from pET28a was ligated to the SmaI digested pNL-eGFP/CEF (Zhang et al. 2002; Zhang et al. 2004; Reiser et al. 2000) and screened for gain of green fluorescence using a Dark Reader light box. The PCR product starts with a BglII sequence and then amplifies the T7 promoter, the LacI binding site (Lac operator), a Shine-Dalgarno sequence, His6, T7 tag, and ends at the beginning of the pET28a MCS. eGFP was strongly expressed from the Rosetta-gami™2(DE3) strain, which bears the T7 RNA polymerase gene. If desired, the insert may be excised again by cleavage with BglII and BamHI and religating. NcoI/XhoI excises eGFP and produces a product that can by ligated to pET28a (NcoI/XhoI) to create a T7 expressed eGFP with a C-terminal His tag for purification.
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionseGFP is strongly expressed in the Rosetta-gami™2(DE3) strain (EMD Millipore) following IPTG induction of the T7 RNA polymerase gene.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHis-T7-eGFP
-
Alt nameHis-tagged, T7-tagged enhanced green fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)864
-
GenBank IDKM019171
- Promoter CMV-EF1α hybrid (CEF)
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- T7 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer cgtcgccgtccagctcgaccag
- 3′ sequencing primer gagcaagggcgaggagctgttc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lentiviral vector with high transduction efficiency. Expression from the CMV-EF1α hybrid (CEF) promoter is very stable in mammalian cells. The lentivirus contains an SV40 origin 5’ to the eGFP gene. This influences gene targeting rates and the preferred strand for gene targeting and recombineering in cells expressing the SV40 T-antigen.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDual-eGFP was a gift from Richard S Myers (Addgene plasmid # 63215 ; http://n2t.net/addgene:63215 ; RRID:Addgene_63215) -
For your References section:
Fluorescent protein engineering by in vivo site-directed mutagenesis. Valledor M, Hu Q, Schiller P, Myers RS. IUBMB Life. 2012 Aug;64(8):684-9. doi: 10.1002/iub.1041. Epub 2012 May 28. 10.1002/iub.1041 PubMed 22639380