This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #64107)


Item Catalog # Description Quantity Price (USD)
Plasmid 64107 Standard format: Plasmid sent in bacteria as agar stab 1 $65
Lentiviral Prep 64107-LV Virus (1 mL at titer > 5x10⁵ TU/mL) and Plasmid. More Information
Concentrated Lentiviral Prep 64107-LVC Virus (75µL at titer > 1×10⁷ TU/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 12980
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Sp dCas9
  • Species
  • Insert Size (bp)
  • Promoter CMV-TO
  • Tag / Fusion Protein
    • 3XsfGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgaaggaatagaagaagaaggtgga
  • 3′ sequencing primer CCAAAGGGAGATCCGACTCG
  • (Common Sequencing Primers)

Resource Information

Information for Lentiviral Prep (Catalog # 64107-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from pHAGE-TO-dCas9-3XGFP (#64107). In addition to the viral particles, you will also receive purified pHAGE-TO-dCas9-3XGFP plasmid DNA.

Lentiviral particles carrying catalytically inactive S. pyogenes Cas9 endonuclease (dCas9) fused to 3XGFP.


  • Volume 1 mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $100 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker GFP


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting Cas9 and the CMV promoter. The PCR product was visualized on an agarose gel for size confirmation.
    Reverse Primer: hdCas9-R2 CCGGCTTTATCCAACTCAGAC
  • Confirmation of protein expression: Lenti-X 293T cells were transduced with serial dilutions of 64107-LV. 96 hours later cells were collected, lysed, and tested for dCas-9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Information for Concentrated Lentiviral Prep (Catalog # 64107-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from pHAGE-TO-dCas9-3XGFP (#64107). In addition to the viral particles, you will also receive purified pHAGE-TO-dCas9-3XGFP plasmid DNA.


  • Volume 75 µL
  • Titer ≥1×10⁷ TU/mL
  • Pricing $150 USD for preparation of 75 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker GFP
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-TO-dCas9-3XGFP was a gift from Thoru Pederson (Addgene plasmid # 64107 ; ; RRID:Addgene_64107)

    For viral preps, please replace (Addgene plasmid # 64107) in the above sentence with: (Addgene viral prep # 64107-LV) or (Addgene viral prep # 64107-LVC)

  • For your References section:

    Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381