pHAGE-TO-dCas9-3XmCherry
(Plasmid #64108)

• Purpose: Expression of Sp dCas9-3XmCherry in mammalian cells
• Depositing Lab: Thoru Pederson
• Publication: Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	64108	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pHAGE-DEST
  (Search Vector Database)
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 12962
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sp dCas9
• Species: Synthetic
• Insert Size (bp): 4101
• Promoter: CMV-TO
• Tag / Fusion Protein:
  • 3XmCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgaaggaatagaagaagaaggtgga
• 3′ sequencing primer: CCAAAGGGAGATCCGACTCG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Terms and Licenses:
  • UBMTA
  • Clontech Limited Use Label License
  • Institut Pasteur Label License for cPPT
• Articles Citing this Plasmid:
  • 5 References