-
PurposeExpression of Sp dCas9-3XmCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 64108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 | ||
Lentiviral Prep | 64108-LV | Virus (1 mL at titer > 1x10⁵ TU/mL) | ||||
Concentrated Lentiviral Prep | 64108-LVC |
Limited Stock Available, 4 units left Virus (100µL at titer > 1×10⁶ TU/mL) |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHAGE-DEST
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 12962
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSp dCas9
-
SpeciesSynthetic
-
Insert Size (bp)4101
- Promoter CMV-TO
-
Tag
/ Fusion Protein
- 3XmCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgaaggaatagaagaagaaggtgga
- 3′ sequencing primer CCAAAGGGAGATCCGACTCG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Terms and Licenses
-
Articles Citing this Plasmid
Information for Lentiviral Prep (Catalog # 64108-LV) ( Back to top )
Purpose
Ready-to-use Lentiviral Prep particles produced from pHAGE-TO-dCas9-3XmCherry (#64108). In addition to the viral particles, you will also receive purified pHAGE-TO-dCas9-3XmCherry plasmid DNA.
Delivery
- Volume 1 mL
- Titer ≥1x10⁵ TU/mL
- Pricing $100 USD for preparation of 1 mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
Viral Quality Control
- Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 64108-LV. 96 hours later, mCherry-positive cells were counted. You can view mCherry expression in dCas9-3XmCherry-transduced cells here or at the image section at the top of this page. Read our fluorescence titering assay protocol here.
- PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting mCherry and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: mCherry-F CCCCGTAATGCAGAAGAAGA
Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA - Confirmation of protein expression: Lenti-X 293T cells were transduced with serial dilutions of 64108-LV. 96 hours later cells were collected, lysed and tested for dCas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.
Visit our viral production page for more information.
Addgene Comments
While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.
To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.
Information for Concentrated Lentiviral Prep (Catalog # 64108-LVC) ( Back to top )
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from pHAGE-TO-dCas9-3XmCherry (#64108). In addition to the viral particles, you will also receive purified pHAGE-TO-dCas9-3XmCherry plasmid DNA.
Delivery
- Volume 100 µL
- Titer ≥1×10⁶ TU/mL
- Pricing $150 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids psPAX2 (plasmid #12260)
- Envelope pMD2.G (plasmid #12259)
- Buffer PBS
- Selectable Marker mCherry
- Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
Viral Quality Control
- Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 64108-LVC. 96 hours later, mCherry-positive cells were counted. Read our fluorescence titering assay protocol here.
- Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-TO-dCas9-3XmCherry was a gift from Thoru Pederson (Addgene plasmid # 64108 ; http://n2t.net/addgene:64108 ; RRID:Addgene_64108)
For viral preps, please replace (Addgene plasmid # 64108) in the above sentence with: (Addgene viral prep # 64108-LV) or (Addgene viral prep # 64108-LVC)
-
For your References section:
Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381