pHAGE-TO-dCas9-3XmCherry
(Plasmid #64108)

• Purpose: Expression of Sp dCas9-3XmCherry in mammalian cells
• Depositing Lab: Thoru Pederson
• Publication: Ma et al Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23.
• Sequence Information:

  • Depositor Sequences: Full (1)
  • Addgene Sequences: Full (1) Partial (2)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	64108	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart
Lentiviral Prep	64108-LV	Virus (1 mL at titer > 1x10⁵ TU/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15	$250	Add to Cart
Concentrated Lentiviral Prep	64108-LVC	Virus (100µL at titer > 1×10⁶ TU/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15	$390	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pHAGE-DEST
  (Search Vector Database)
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 12962
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sp dCas9
• Species: Synthetic
• Insert Size (bp): 4101
• Promoter: CMV-TO
• Tag / Fusion Protein:
  • 3XmCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: cgaaggaatagaagaagaaggtgga
• 3′ sequencing primer: CCAAAGGGAGATCCGACTCG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Terms and Licenses:
  • UBMTA
  • Clontech Limited Use Label License
  • Institut Pasteur Label License for cPPT
• Articles Citing this Plasmid:
  • 2 References

Information for Lentiviral Prep (Catalog # 64108-LV)

Purpose

Ready-to-use Lentiviral Prep particles produced from pHAGE-TO-dCas9-3XmCherry (#64108). In addition to the viral particles, you will also receive purified pHAGE-TO-dCas9-3XmCherry plasmid DNA.

Delivery

• Volume: 1 mL
• Titer: ≥1x10⁵ TU/mL
• Pricing: $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: DMEM +10% FBS
• Selectable Marker: mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors

Viral Quality Control

Titering Method:

• Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 64108-LV. 96 hours later, mCherry-positive cells were counted. You can view mCherry expression in dCas9-3XmCherry-transduced cells here or at the image section at the top of this page. Read our fluorescence titering assay protocol here.

Notes:

• PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting mCherry and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: mCherry-F CCCCGTAATGCAGAAGAAGA
  Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
• Confirmation of protein expression: Lenti-X 293T cells were transduced with serial dilutions of 64108-LV. 96 hours later cells were collected, lysed and tested for dCas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Information for Concentrated Lentiviral Prep (Catalog # 64108-LVC)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from pHAGE-TO-dCas9-3XmCherry (#64108). In addition to the viral particles, you will also receive purified pHAGE-TO-dCas9-3XmCherry plasmid DNA.

Delivery

• Volume: 100 µL
• Titer: ≥1×10⁶ TU/mL
• Pricing: $360 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: PBS
• Selectable Marker: mCherry
• Purification: Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors

Viral Quality Control

Titering Method:

• Direct fluorescence: Lenti-X cells were transduced with serial dilutions of 64108-LVC. 96 hours later, mCherry-positive cells were counted. Read our fluorescence titering assay protocol here.

Notes:

• Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.