Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBa-KIF5C 559-tdTomato-FKBP
(Plasmid #64211)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64211 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBa.KIF5C 1-559.eGFP
  • Backbone manufacturer
    Banker lab (Addgene plasmid #45059)
  • Backbone size w/o insert (bp) 8410
  • Total vector size (bp) 9444
  • Modifications to backbone
    GFP removed and tdTomato-FKBP added
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kif5c
  • Alt name
    Kif5c560
  • Alt name
    kinesin family member 5C
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1676
  • Mutation
    motor domain aa1-559
  • GenBank ID
    NM_001107730.1
  • Entrez Gene
    Kif5c
  • Promoter chicken Beta Actin
  • Tags / Fusion Proteins
    • tdTomato (C terminal on insert)
    • FKBP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kif 5c received from Bruce Schnapp, Oregon Health & Science University
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 64211 ; http://n2t.net/addgene:64211 ; RRID:Addgene_64211)
  • For your References section:

    A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations. Bentley M, Decker H, Luisi J, Banker G. J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26. 10.1083/jcb.201408056 PubMed 25624392