pRPR1_c1gRNA_RPR1t
(Plasmid
#64379)
-
Purposeencodes c1 gRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 64379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS425
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4020
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namec1 gRNA
-
gRNA/shRNA sequenceCTAGATATTAAAATGTCTAA
-
SpeciesS. cerevisiae (budding yeast)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRPR1_c1gRNA_RPR1t was a gift from Timothy Lu (Addgene plasmid # 64379 ; http://n2t.net/addgene:64379 ; RRID:Addgene_64379) -
For your References section:
Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949