pLVX-IRES-tdTomato-FlagAkt2
(Plasmid
#64832)
-
PurposeLentiviral expression of murine Flag-Akt2
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-IRES-tdTomato
- Backbone size w/o insert (bp) 8892
- Total vector size (bp) 10407
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAkt2
-
Alt namePKBbeta, thymoma viral proto-oncogene 2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1515
-
GenBank IDNM_007434.3
-
Entrez GeneAkt2 (a.k.a. 2410016A19Rik, PKB, PKBbeta)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GACCTCCATAGAAGACACCGACT
- 3′ sequencing primer GCCTTATTCCAAGCGGCTTCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-IRES-tdTomato-FlagAkt2 was a gift from Eva Gonzalez (Addgene plasmid # 64832 ; http://n2t.net/addgene:64832 ; RRID:Addgene_64832) -
For your References section:
Development of a new model system to dissect isoform specific Akt signaling in adipocytes. Kajno E, McGraw TE, Gonzalez E. Biochem J. 2015 Apr 9. 10.1042/BJ20150191 PubMed 25856301