pLncEXP-lnc-BATE1
(Plasmid
#64864)
-
PurposeExpresses the longest isoform of lnc-BATE1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSIREN-RetroQZsGreen
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 6300
-
Modifications to backboneU6 promoter and partial sequence downstream ZsGreen was removed from the backbone. ZsGreen coding sequence was replaced by lnc-BATE1.
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelnc-BATE1
-
gRNA/shRNA sequenceGCCTTCCTTTAGACTTGACCT
-
SpeciesM. musculus (mouse)
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gagctggtttagtgaacggtca
- 3′ sequencing primer cctacaggtggggtctttca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLncEXP-lnc-BATE1 was a gift from Lei Sun (Addgene plasmid # 64864 ; http://n2t.net/addgene:64864 ; RRID:Addgene_64864) -
For your References section:
De Novo Reconstruction of Adipose Tissue Transcriptomes Reveals Long Non-coding RNA Regulators of Brown Adipocyte Development. Alvarez-Dominguez JR, Bai Z, Xu D, Yuan B, Lo KA, Yoon MJ, Lim YC, Knoll M, Slavov N, Chen S, Chen P, Lodish HF, Sun L. Cell Metab. 2015 May 5;21(5):764-76. doi: 10.1016/j.cmet.2015.04.003. Epub 2015 Apr 23. 10.1016/j.cmet.2015.04.003 PubMed 25921091
Map uploaded by the depositor.