-
Purpose(Empty Backbone) lentiviral vector with Flag, HA tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Cloning Grade DNA | 64874-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $105 |
Backbone
-
Vector backbonepCDH-CMV-MCS-EF1-Puro
-
Backbone manufacturerSystem Biosciences
-
Modifications to backboneAddition of FLAG and HA tags
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
-
Tags
/ Fusion Proteins
- Flag (C terminal on backbone)
- HA (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer EF1a-F_alt (gccgtgaacgttctttttc)
- 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Cloning Grade DNA (Catalog # 64874-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $105 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EF1-FHC was a gift from Richard Wood (Addgene plasmid # 64874 ; http://n2t.net/addgene:64874 ; RRID:Addgene_64874) -
For your References section:
Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PGENETICS-D-14-01461 [pii] PubMed 25275444