Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65221)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 65221 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6546
  • Modifications to backbone
    in-frame HA tag between ApaI and XhoI sites of pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    deleted AA 18-473
  • GenBank ID
  • Entrez Gene
    ADAM17 (a.k.a. ADAM18, CD156B, CSVP, NISBD, NISBD1, TACE)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Mutagenesis creates EcoRV site 57bp downstream of Start ATG.
Insert contains several point mutations compared to NM_003183 (see sequence).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Delta(Pro-MP)ADAM17-HA was a gift from Axel Ullrich (Addgene plasmid # 65221 ; ; RRID:Addgene_65221)
  • For your References section:

    TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells. Gschwind A, Hart S, Fischer OM, Ullrich A. EMBO J. 2003 May 15;22(10):2411-21. 10.1093/emboj/cdg231 PubMed 12743035