Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65419)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 65419 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
  • Entrez Gene
    Il2 (a.k.a. Il-2)
  • Promoter Modified CMV Promoter
  • Tag / Fusion Protein
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCACCAGACATAATAGCTGAC
  • 3′ sequencing primer GCTCTGATCTTTTATTAGCCAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FcD265A-IL2 was a gift from Dane Wittrup (Addgene plasmid # 65419 ; ; RRID:Addgene_65419)
  • For your References section:

    Synergistic Innate and Adaptive Immune Response to Combination Immunotherapy with Anti-Tumor Antigen Antibodies and Extended Serum Half-Life IL-2. Zhu EF, Gai SA, Opel CF, Kwan BH, Surana R, Mihm MC, Kauke MJ, Moynihan KD, Angelini A, Williams RT, Stephan MT, Kim JS, Yaffe MB, Irvine DJ, Weiner LM, Dranoff G, Wittrup KD. Cancer Cell. 2015 Apr 13;27(4):489-501. doi: 10.1016/j.ccell.2015.03.004. 10.1016/j.ccell.2015.03.004 PubMed 25873172