-
PurposePquas-Δpes10-GFP-3'UTR-unc-54
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSM
-
Backbone manufacturerC.I. Bargmann and S. MaCarroll
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4688
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5XQUAS-delta-pes-10
-
Alt nameQUAS
-
SpeciesNeurospora crassa
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5xQUAS-hsp70 was amplified from pQUAS-CD8-GFP3 with primers 5’- ACTTACTTGCATGCGGATCCGGGTAATCGCTTA and 3’- AGTGGCGCGCCCAATTCCCTATTCAGAGTTC, and the fragment was inserted into SphI and AscI sites of pSM-GFP. Δpes-10 minimal promoter was amplified from pPD97.78 (A. Fire) with primers 5’- GCAAGTGATATCCCTGCAGGATCGATTTT
TTGCA and 3’- GATGGCGCGCCCTGAAAGTTAAAAATTACAGTATAAAGATA
AGGGA, and was subcloned into the EcoRV-AscI fragment from P5xQUAS-hsp70-GFP, replacing the hsp-70 minimal promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XW12 was a gift from Kang Shen (Addgene plasmid # 65834 ; http://n2t.net/addgene:65834 ; RRID:Addgene_65834) -
For your References section:
Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Wei X, Potter CJ, Luo L, Shen K. Nat Methods. 2012 Mar 11;9(4):391-5. doi: 10.1038/nmeth.1929. 10.1038/nmeth.1929 PubMed 22406855