XW54
(Plasmid
#65839)
-
PurposePunc-4c-NLS-QF-BD-DM-Nzipper-SL2-mCherry-3'UTR-unc-54 for Split Q intersectional method
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSM
-
Backbone manufacturerC.I. Bargmann and S. MaCarroll
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 7712
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-QF-BD-DM-Zipper
-
SpeciesNeurospora crassa
-
Insert Size (bp)2110
-
GenBank ID
- Promoter Punc-4c
-
Tag
/ Fusion Protein
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ggaattgtgagcggataacaatt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XW54 was a gift from Kang Shen (Addgene plasmid # 65839 ; http://n2t.net/addgene:65839 ; RRID:Addgene_65839) -
For your References section:
Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Wei X, Potter CJ, Luo L, Shen K. Nat Methods. 2012 Mar 11;9(4):391-5. doi: 10.1038/nmeth.1929. 10.1038/nmeth.1929 PubMed 22406855