pX330.iGFP3
(Plasmid
#66583)
-
PurposesgRNA for iGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 66583 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiGFP
-
gRNA/shRNA sequencegatatcgaattcctgcagcc
-
GenBank ID
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330.iGFP3 was a gift from Wen Xue (Addgene plasmid # 66583 ; http://n2t.net/addgene:66583 ; RRID:Addgene_66583) -
For your References section:
A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Li Y, Park A, Mou H, Colpan C, Bizhanova A, Akama-Garren E, Joshi N, Hendrickson EA, Feldser D, Yin H, Anderson DG, Jacks T, Weng Z, Xue W. Genome Biol. 2015 May 28;16(1):111. 10.1186/s13059-015-0680-7 [pii] PubMed 26018130