NmCherry-SpVasa
(Plasmid
#66786)
-
Purposeexpression of mCherry in Sea Urchin germ cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+8
-
Backbone manufacturerAddgene Plasmid #3493, Gökirmak et al. 2012, JBC
- Backbone size w/o insert (bp) 4851
-
Vector typeMammalian Expression ; sea urchin, zebrafish, xenopus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVasa
-
SpeciesStrongylocentrotus purpuratus (Sea urchin)
-
Insert Size (bp)2301
- Promoter SP6
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer TGTTGTTAACTTGTTTATTGCAGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NmCherry-SpVasa was a gift from Amro Hamdoun (Addgene plasmid # 66786 ; http://n2t.net/addgene:66786 ; RRID:Addgene_66786) -
For your References section:
Programmed reduction of ABC transporter activity in sea urchin germline progenitors. Campanale JP, Hamdoun A. Development. 2012 Feb;139(4):783-92. doi: 10.1242/dev.076752. 10.1242/dev.076752 PubMed 22274698