LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
(Plasmid
#67277)
-
Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 16500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namefirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
-
Insert Size (bp)1500
- Promoter CAG
-
Tag
/ Fusion Protein
- red flourescent gene katushka linked to puro through a E2A site (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (unknown if destroyed)
- 3′ cloning site Asis (unknown if destroyed)
- 5′ sequencing primer gctggttgttgtgctgtctc
- 3′ sequencing primer cagacccttgccctggtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesecond cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
-
Insert Size (bp)5700
- Promoter CAG
-
Tag
/ Fusion Protein
- mTQ2 blue fluorescent (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Asis (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer gatcacatggtcctgctg
- 3′ sequencing primer acaccgaggagaatgtcaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 67277 ; http://n2t.net/addgene:67277 ; RRID:Addgene_67277) -
For your References section:
A genetically inducible porcine model of intestinal cancer. Callesen MM, Arnadottir SS, Lyskjaer I, Orntoft MW, Hoyer S, Dagnaes-Hansen F, Liu Y, Li R, Callesen H, Rasmussen MH, Berthelsen MF, Thomsen MK, Schweiger PJ, Jensen KB, Laurberg S, Orntoft TF, Elverlov-Jakobsen JE, Andersen CL. Mol Oncol. 2017 Nov;11(11):1616-1629. doi: 10.1002/1878-0261.12136. Epub 2017 Oct 10. 10.1002/1878-0261.12136 PubMed 28881081