Villinpromoter-blue-FlpOERT2
(Plasmid #67278)

• Purpose: 4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon context
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Callesen et al Mol Oncol. 2017 Nov;11(11):1616-1629. doi: 10.1002/1878-0261.12136. Epub 2017 Oct 10.

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 17000

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mTQ2=mturquoise2 blue fluorescent gene
• Species: blue fluorescent gene
• Insert Size (bp): 800
• Promoter: Villin
• Tag / Fusion Protein:
  • linked to FlpO through an P2A ribosomal skipping site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (unknown if destroyed)
• 3′ cloning site: Bstz17I (unknown if destroyed)
• 5′ sequencing primer: tagaggttggactacagtgg
• 3′ sequencing primer: tcttgatgtcgctgaacctg

Resource Information

• Supplemental Documents:
  • Villin_GOLD 9KB med LIR og RIR og RMCE loxP og FlpOERT2 med NLS
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry