Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #67637)


Item Catalog # Description Quantity Price (USD)
Plasmid 67637 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Jeng-Shin Lee, Harvard University
  • Total vector size (bp) 8617
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    Ppargc1a, peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Ppargc1a (a.k.a. A830037N07Rik, Gm11133, PGC-1, PPARGC-1-alpha, Pgc-1alpha, Pgc1, Pgco1, Ppargc1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag tag (N terminal on insert)
    • 6XHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer tattggctcatgtccaacat
  • 3′ sequencing primer ataagacaacagagacaact
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Flag-PGC1a-6His sequence was obtained from Bruce Spiegelman Lab. Note that there is a Q339K mutation relative to the canonical GenBank sequence. This mutation has not been reported to affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CMV-Flag-PGC1a-6His was a gift from Connie Cepko (Addgene plasmid # 67637 ; ; RRID:Addgene_67637)
  • For your References section:

    NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI, Cepko CL. J Clin Invest. 2015 Apr;125(4):1433-45. doi: 10.1172/JCI79735. Epub 2015 Mar 23. 10.1172/JCI79735 PubMed 25798616