Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #67845)


Item Catalog # Description Quantity Price (USD)
Plasmid 67845 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2700
  • Total vector size (bp) 5908
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse), Synthetic
  • Promoter h-synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CGTAATGCAGAAGAAGACTATG
  • 3′ sequencing primer CCATGTAGATGGACTTGAACTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    this plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid.

transgene expression is Cre-dependent; contains flex switch

All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands.

The insert was read using primers in the dsred sequence:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsyn-flex-dsRed-shvgat was a gift from William Wisden (Addgene plasmid # 67845 ; ; RRID:Addgene_67845)
  • For your References section:

    Wakefulness Is Governed by GABA and Histamine Cotransmission. Yu X, Ye Z, Houston CM, Zecharia AY, Ma Y, Zhang Z, Uygun DS, Parker S, Vyssotski AL, Yustos R, Franks NP, Brickley SG, Wisden W. Neuron. 2015 Jun 17. pii: S0896-6273(15)00516-4. doi: 10.1016/j.neuron.2015.06.003. 10.1016/j.neuron.2015.06.003 PubMed 26094607