AAV-actin prom-dsRed-adra2a.1227.shRNA
(Plasmid #67880)

• Purpose: expresses dsRed and shRNA to knock down adra2a receptors
• Depositing Lab: William Wisden
• Publication: Zhang et al Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 7100
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dsRed and shRNA to knock down the mouse adra2 receptor
• Species: G. gallus (chicken), Synthetic
• Insert Size (bp): 4000
• Promoter: chicken beta actin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: TGCTAACCATGTTCATGCCTTC
• 3′ sequencing primer: GACCCGGCAGCAGGCCGCGGGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute), and then subcloned into an AAV vector.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute). Inserts in pPRIME were released by SbfI and PacI digestion, and cloned into the PstI and PacI sites in the polylinker of the AAV-genome plasmid pAM-flex (Murray AJ et al.2011 Nat Neurosci 14, p297), to give ITR-cmv-Penhancer/chicken β-actin-dsRED-mir30-shRNA-woodchuck post-translational regulatory sequence (WPRE)-bovine growth hormone polyadenylation signal (pA)-ITR. The sh RNA knocks down mouse adra2a expression.