Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-actin prom-dsRed-adra2a.1227.shRNA
(Plasmid #67880)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 67880 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 7100
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    dsRed and shRNA to knock down the mouse adra2 receptor
  • Species
    G. gallus (chicken), Synthetic
  • Insert Size (bp)
  • Promoter chicken beta actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer TGCTAACCATGTTCATGCCTTC
  • 3′ sequencing primer GACCCGGCAGCAGGCCGCGGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute), and then subcloned into an AAV vector.
  • Terms and Licenses

Depositor Comments

The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute). Inserts in pPRIME were released by SbfI and PacI digestion, and cloned into the PstI and PacI sites in the polylinker of the AAV-genome plasmid pAM-flex (Murray AJ et al.2011 Nat Neurosci 14, p297), to give ITR-cmv-Penhancer/chicken β-actin-dsRED-mir30-shRNA-woodchuck post-translational regulatory sequence (WPRE)-bovine growth hormone polyadenylation signal (pA)-ITR. The sh RNA knocks down mouse adra2a expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-actin prom-dsRed-adra2a.1227.shRNA was a gift from William Wisden (Addgene plasmid # 67880 ; ; RRID:Addgene_67880)
  • For your References section:

    Neuronal ensembles sufficient for recovery sleep and the sedative actions of alpha2 adrenergic agonists. Zhang Z, Ferretti V, Guntan I, Moro A, Steinberg EA, Ye Z, Zecharia AY, Yu X, Vyssotski AL, Brickley SG, Yustos R, Pillidge ZE, Harding EC, Wisden W, Franks NP. Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23. 10.1038/nn.3957 PubMed 25706476