AAV-actin prom-dsRed-scramble shRNA
(Plasmid #67879)

• Purpose: AAV vector to express dsRed sh RNA (scramble)
• Depositing Lab: William Wisden
• Publication: Zhang et al Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 7200
• Vector type: Mammalian Expression, AAV, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: actin prom-dsRed-scramble shRNA
• Species: G. gallus (chicken), Synthetic
• Insert Size (bp): 3115
• Promoter: chicken beta actin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: CTGGCGGTGACCGGCGGCTCTAG
• 3′ sequencing primer: GACCCGGCAGCAGGCCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: To make this plasmid we started with plasmid pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To express shRNAs, we used the pPRIME system. This generates
micro-RNA-30 (mir30)-derived shRNAs and co-expression of a marker protein, such as dsRED, from the same transcript. The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 and then cloned into the AAV vector (Zhang et al 2015 Nat Neurosci),
SbfI(or PstI) + PacI will retrieve the 2.1kb insert (dsRed-scramble shRNA-chloramphenicol) and the 5.1kb AAV-CBA backbone, which is ampicillin resistant. The SbfI site in the middle of dsRed has been silenced. The construct can be linearised with XhoI.