Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-actin prom-dsRed-scramble shRNA
(Plasmid #67879)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 67879 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    actin prom-dsRed-scramble shRNA
  • Species
    G. gallus (chicken), Synthetic
  • Insert Size (bp)
  • Promoter chicken beta actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer CTGGCGGTGACCGGCGGCTCTAG
  • 3′ sequencing primer GACCCGGCAGCAGGCCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

To express shRNAs, we used the pPRIME system. This generates
micro-RNA-30 (mir30)-derived shRNAs and co-expression of a marker protein, such as dsRED, from the same transcript. The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 and then cloned into the AAV vector (Zhang et al 2015 Nat Neurosci),
SbfI(or PstI) + PacI will retrieve the 2.1kb insert (dsRed-scramble shRNA-chloramphenicol) and the 5.1kb AAV-CBA backbone, which is ampicillin resistant. The SbfI site in the middle of dsRed has been silenced. The construct can be linearised with XhoI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-actin prom-dsRed-scramble shRNA was a gift from William Wisden (Addgene plasmid # 67879 ; ; RRID:Addgene_67879)
  • For your References section:

    Neuronal ensembles sufficient for recovery sleep and the sedative actions of alpha2 adrenergic agonists. Zhang Z, Ferretti V, Guntan I, Moro A, Steinberg EA, Ye Z, Zecharia AY, Yu X, Vyssotski AL, Brickley SG, Yustos R, Pillidge ZE, Harding EC, Wisden W, Franks NP. Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23. 10.1038/nn.3957 PubMed 25706476