Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-EF1-IRES-NEO mutant ITR
(Plasmid #67905)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67905 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB-EF1-IRES-NEO
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 6892
  • Modifications to backbone
    Inverted terminal repeats mutated from GGG>ATA
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NeoR
  • Species
    Synthetic
  • Entrez Gene
    neoR (a.k.a. pSH111_227_223)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGGTTCCGCGCACATTTC
  • 3′ sequencing primer CAGTCATCCTCGGCAAACTCTTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-EF1-IRES-NEO mutant ITR was a gift from Alex Kentsis (Addgene plasmid # 67905 ; http://n2t.net/addgene:67905 ; RRID:Addgene_67905)
  • For your References section:

    Genomic DNA transposition induced by human PGBD5. Henssen AG, Henaff E, Jiang E, Eisenberg AR, Carson JR, Villasante CM, Ray M, Still E, Burns M, Gandara J, Feschotte C, Mason CE, Kentsis A. Elife. 2015 Sep 25;4. pii: e10565. doi: 10.7554/eLife.10565. 10.7554/eLife.10565 PubMed 26406119