pSIJ8
(Plasmid #68122)

• Purpose: Temperature sensitive plasmid for either lambda Red recombinase genes or flippase recombinase expression
• Depositing Lab: Alex Nielsen
• Publication: Jensen et al Sci Rep. 2015 Dec 8;5:17874. doi: 10.1038/srep17874.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	68122	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pkd46
  (Search Vector Database)
• Backbone manufacturer: Datsenko and Wanner, 2000
• Backbone size w/o insert (bp): 6330
• Total vector size (bp): 9647
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 30°C
• Growth Strain(s): XL1 Blue
• Growth instructions: Temperature sensitive origin.
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: flp recombinase
• Insert Size (bp): 1272
• GenBank ID: AF048702.1
• Promoter: rhamnose

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tatgtcgtgattgagcggga
• 3′ sequencing primer: caccacaattcagcaaattgtg

Gene/Insert 2

• Gene/Insert name: rhaS
• Species: E. coli
• Insert Size (bp): 837
• Promoter: rhamnose

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctcctcaatttcattacgaccag
• 3′ sequencing primer: GTCCGTTATGTAGGTAGGAATCT

Gene/Insert 3

• Gene/Insert name: rhaR
• Species: E. coli
• Insert Size (bp): 849
• Promoter: rhamnose

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ttaagcagcaaacgggactg
• 3′ sequencing primer: TCAGATTCCTACCTACATAACGGAC

Resource Information

• Supplemental Documents:
  • GenBank file
• Terms and Licenses:
  • UBMTA