-
PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for monocotyledonous plants
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH47742 (AddGene #47742)
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCan also be grown in Agrobacterium tumefaciens GV3101/ LBA4404. Will be low copy in this species.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter/5UTR: ZmUbi + CDS:SpCas9 + 3UTR/terminator:35s
-
Alt nameZmUbi_Cas9_35s
-
SpeciesZea mays, Streptococcus pyogenes, Cauliflower Mosaic Virus
-
Insert Size (bp)6404
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
- 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Cas9 coding sequence came from pICH41308 (Addgene#49770). A gift from Sophien Kamoun.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL11056 was a gift from Nicola Patron (Addgene plasmid # 68258 ; http://n2t.net/addgene:68258 ; RRID:Addgene_68258) -
For your References section:
Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Lawrenson T, Shorinola O, Stacey N, Li C, Ostergaard L, Patron N, Uauy C, Harwood W. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. 10.1186/s13059-015-0826-7 [pii] PubMed 26616834