Cx43K258stop-msfGFP
(Plasmid
#69023)
-
PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with msfGFP on the C-terminus. CMV promoter.
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneEGFP-N1
- Total vector size (bp) 5518
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCx43
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)768
-
Mutationdelete codons 258-381 and fuse in frame to monomeric superfolder GFP
-
Entrez GeneGja1 (a.k.a. Cx43, Cxnk1)
- Promoter CMV
-
Tag
/ Fusion Protein
- V206K monomerized super folder GFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV
- 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addition of a fluorescent protein tag to the carboxyl-terminus of Cx43 has been shown to eliminate or attenuate interactions with ZO-1 and Occludin in cell culture. Other binding interactions and channel gating properties may be affected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cx43K258stop-msfGFP was a gift from David Spray (Addgene plasmid # 69023 ; http://n2t.net/addgene:69023 ; RRID:Addgene_69023) -
For your References section:
Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468