sfGFP-Cx43K258stop
(Plasmid
#69025)
-
PurposeExpresses rat Cx43 (Gja1 CDS) truncated at amino acid 258 and tagged with sfGFP (V206-version) on the N-terminus. CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP-C1
- Total vector size (bp) 5514
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCx43
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)768
-
Mutationnon-monomerized sfGFP fused in frame to N-terminus of truncated Cx43delete codons 258-381 of the Cx43 CDS
-
Entrez GeneGja1 (a.k.a. Cx43, Cxnk1)
- Promoter CMV
-
Tag
/ Fusion Protein
- super folder GFP (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV
- 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note all connexins tested that have a fluorescent protein fused to the connexin amino-terminus do not form functional channels. This plasmid forms gap junction plaque structures but does not produce intercellular coupling.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sfGFP-Cx43K258stop was a gift from David Spray (Addgene plasmid # 69025 ; http://n2t.net/addgene:69025 ; RRID:Addgene_69025) -
For your References section:
Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468