Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69573)


Item Catalog # Description Quantity Price (USD)
Plasmid 69573 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4823
  • Total vector size (bp) 6278
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    kozak consensus - C-CreintG
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGACTTCCTTTGTCCCAAATCTG
  • 3′ sequencing primer TAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GBP2 obtained from Heinrich Leonardt and Ulrich Rothbauer at Ludwig Maximilians University Munich
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-C-CreintG was a gift from Connie Cepko (Addgene plasmid # 69573 ; ; RRID:Addgene_69573)
  • For your References section:

    Cell type-specific manipulation with GFP-dependent Cre recombinase. Tang JC, Rudolph S, Dhande OS, Abraira VE, Choi S, Lapan SW, Drew IR, Drokhlyansky E, Huberman AD, Regehr WG, Cepko CL. Nat Neurosci. 2015 Sep;18(9):1334-41. doi: 10.1038/nn.4081. Epub 2015 Aug 10. 10.1038/nn.4081 PubMed 26258682