-
PurposeOne half component of the optimized Cre recombinase dependent on GFP (CRE-DOG OPT) for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 69572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG-GFP
- Backbone size w/o insert (bp) 4823
- Total vector size (bp) 5579
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namekozak consensus - N-CretrcintG
-
SpeciesSynthetic
-
Insert Size (bp)756
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGACTTCCTTTGTCCCAAATCTG
- 3′ sequencing primer TAGCCAGAAGTCAGATGCTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGBP7 obtained from Heinrich Leonardt and Ulrich Rothbauer at Ludwig Maximilians University Munich
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-N-CretrcintG was a gift from Connie Cepko (Addgene plasmid # 69572 ; http://n2t.net/addgene:69572 ; RRID:Addgene_69572) -
For your References section:
Cell type-specific manipulation with GFP-dependent Cre recombinase. Tang JC, Rudolph S, Dhande OS, Abraira VE, Choi S, Lapan SW, Drew IR, Drokhlyansky E, Huberman AD, Regehr WG, Cepko CL. Nat Neurosci. 2015 Sep;18(9):1334-41. doi: 10.1038/nn.4081. Epub 2015 Aug 10. 10.1038/nn.4081 PubMed 26258682