Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69801)


Item Catalog # Description Quantity Price (USD)
Plasmid 69801 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    px330 (Addgene 42230)
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8526
  • Modifications to backbone
    The R1 sgRNA genome targeting sequence was cloned into the pX330 vector
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Chicken Beta-Actin

Cloning Information for Gene/Insert 2

Resource Information

  • Terms and Licenses

Depositor Comments

the pX330 vector, created by the laboratory of Dr. Feng Zhang and obtained from Addgene (Plasmid 42230), was used. The R1 sgRNA genome targeting sequence was cloned into the pX330 vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-mitf was a gift from Jianguo Zhao (Addgene plasmid # 69801 ; ; RRID:Addgene_69801)
  • For your References section:

    Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Wang X, Zhou J, Cao C, Huang J, Hai T, Wang Y, Zheng Q, Zhang H, Qin G, Miao X, Wang H, Cao S, Zhou Q, Zhao J. Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348. 10.1038/srep13348 PubMed 26293209