Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69805)


Item Catalog # Description Quantity Price (USD)
Plasmid 69805 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    xlox dNGFR
  • Backbone manufacturer
    in lab construct
  • Backbone size w/o insert (bp) 6588
  • Total vector size (bp) 9987
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    hTERT reverse transcriptase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    TERT (a.k.a. CMM9, DKCA2, DKCB4, EST2, PFBMFT1, TCS1, TP2, TRT, hEST2, hTRT)
  • Promoter MLV promoter
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCGATCCTCCCTTTATCCA
  • 3′ sequencing primer GCATGCTCCAGACTGCCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Modified here from a full-length cDNA clone (IMAGE: 5263715) Life Technologies, Carlsbad, CA.
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    xlox dNGFR-TERT was a gift from David Ott (Addgene plasmid # 69805 ; ; RRID:Addgene_69805)
  • For your References section:

    Transduction with human telomerase reverse transcriptase immortalizes a rhesus macaque CD8+ T cell clone with maintenance of surface marker phenotype and function. Andersen H, Barsov EV, Trivett MT, Trubey CM, Giavedoni LD, Lifson JD, Ott DE, Ohlen C. AIDS Res Hum Retroviruses. 2007 Mar;23(3):456-65. 10.1089/aid.2006.0194 PubMed 17411379