Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #70188)


Item Catalog # Description Quantity Price (USD)
Plasmid 70188 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Fagan and Fairweather 2009
  • Backbone size w/o insert (bp) 7216
  • Total vector size (bp) 9178
  • Modifications to backbone
    Replaced gusA from original pRPF185 with amyEopt
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    For E.coli, use Cm at 20ug/mL for growth on solid media, but 10ug/mL for growth in liquid medium. For C. difficile use thiamphenicol at 15ug/mL.
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    secreted alpha-amylase
  • Species
  • Insert Size (bp)
  • Promoter Ptet

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 3′ sequencing primer NF_794 (CACCGACGAGCAAGGCAAGACCG)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note: the depositing lab has determined that a particular IS element present in E. coli strains such as DH5alpha and its derivatives has a high propensity to insert into this plasmid. The depositing lab recommends isolating the plasmid DNA and transforming into a strain similar to MC1061.

Publication describing the backbone vector pRPF185 as well as the sequencing primers:
Clostridium difficile has two parallel and essential Sec secretion systems. Fagan RP, Fairweather NF. J Biol Chem. 2011 Aug 5;286(31):27483-93. doi: 10.1074/jbc.M111.263889. Epub 2011 Jun 9.
PMID: 21659510

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWKS1583 was a gift from Wiep Klaas Smits (Addgene plasmid # 70188 ; ; RRID:Addgene_70188)
  • For your References section:

    The Signal Sequence of the Abundant Extracellular Metalloprotease PPEP-1 Can Be Used to Secrete Synthetic Reporter Proteins in Clostridium difficile. Oliveira Paiva AM, Friggen AH, Hossein-Javaheri S, Smits WK. ACS Synth Biol. 2016 Jun 23. 10.1021/acssynbio.6b00104 PubMed 27333161