Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #105497)


Item Catalog # Description Quantity Price (USD)
Plasmid 105497 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    R.P. Fagan, University of Sheffield
  • Total vector size (bp) 8073
  • Vector type
    ATc-dependent expression in C. difficile

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    C. difficile / synthetic
  • Insert Size (bp)
  • Promoter Ptet

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAF257 was a gift from Wiep Klaas Smits (Addgene plasmid # 105497 ; ; RRID:Addgene_105497)
  • For your References section:

    The Bacterial Chromatin Protein HupA Can Remodel DNA and Associates with the Nucleoid in Clostridium difficile. Oliveira Paiva AM, Friggen AH, Qin L, Douwes R, Dame RT, Smits WK. J Mol Biol. 2019 Jan 8. pii: S0022-2836(18)31160-4. doi: 10.1016/j.jmb.2019.01.001. 10.1016/j.jmb.2019.01.001 PubMed 30633871