Holiday Schedule: Addgene will be closed December 22nd & 25th and December 29th & January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-mOXT-hM3Dq-mCherry-WPRE
(Plasmid #70717)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70717 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5142
  • Total vector size (bp) 7600
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hM3Dq-mCherry
  • Alt name
    DREADDs-mCherry
  • Species
    H. sapiens (human), Synthetic
  • Promoter mouse oxytocin
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTTATGCTAGCGCCACCATG
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid is derived as a modification from Addgene Plasmid #44361 - pAAV-hSyn-DIO-hM3D(Gq)-mCherry.
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-mOXT-hM3Dq-mCherry-WPRE was a gift from Daniel Geschwind (Addgene plasmid # 70717)
  • For your References section:

    Exogenous and evoked oxytocin restores social behavior in the Cntnap2 mouse model of autism. Penagarikano O, Lazaro MT, Lu XH, Gordon A, Dong H, Lam HA, Peles E, Maidment NT, Murphy NP, Yang XW, Golshani P, Geschwind DH. Sci Transl Med. 2015 Jan 21;7(271):271ra8. doi: 10.1126/scitranslmed.3010257. 10.1126/scitranslmed.3010257 PubMed 25609168