Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71451)


Item Catalog # Description Quantity Price (USD)
Plasmid 71451 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Andrei Gudkov lab
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    STAT2 (a.k.a. IMD44, ISGF-3, P113, PTORCH3, STAT113)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGAGTTTGTTTTGGCACCA
  • 3′ sequencing primer CTCTTTCAGAGGTTATTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-STAT2 was a gift from George Stark (Addgene plasmid # 71451 ; ; RRID:Addgene_71451)
  • For your References section:

    IFNbeta-dependent increases in STAT1, STAT2, and IRF9 mediate resistance to viruses and DNA damage. Cheon H, Holvey-Bates EG, Schoggins JW, Forster S, Hertzog P, Imanaka N, Rice CM, Jackson MW, Junk DJ, Stark GR. EMBO J. 2013 Oct 16;32(20):2751-63. doi: 10.1038/emboj.2013.203. Epub 2013 Sep 24. 10.1038/emboj.2013.203 PubMed 24065129