Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p404-BrdU-Inc
(Plasmid #71790)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71790 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS404
  • Backbone size w/o insert (bp) 4271
  • Total vector size (bp) 10199
  • Modifications to backbone
    XbaI site in polylinker mutated
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Thymidine Kinase
  • Species
    Herpers Simplex Virus
  • Insert Size (bp)
    2100
  • GenBank ID
    J02224.1
  • Promoter GPD

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    ENT1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1300
  • GenBank ID
    AF079117.1
  • Entrez Gene
    SLC29A1 (a.k.a. ENT1)
  • Promoter ADH1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer agcggataacaatttcacacagg
  • 3′ sequencing primer cgccagggttttcccagtcacgac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    HSV-TK from E. Schwob hENT1 from C. Cass

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p404-BrdU-Inc was a gift from Oscar Aparicio (Addgene plasmid # 71790 ; http://n2t.net/addgene:71790 ; RRID:Addgene_71790)
  • For your References section:

    New vectors for simplified construction of BrdU-Incorporating strains of Saccharomyces cerevisiae. Viggiani CJ, Aparicio OM. Yeast. 2006 Oct-Nov;23(14-15):1045-51. 10.1002/yea.1406 PubMed 17083135