-
PurposeGFP-tagged mSin1 (isoform 1)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6290
-
Modifications to backboneKozak and start ATG before eGFP were mutated: caccatgg to aaccttgg Linker was added before Kozak (aaccttgg): cgggcccgggatccaccggtcgc
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemSin1.1
-
Alt nameMAPKAP1
-
Alt namestress-activated map kinase interacting protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1566
-
Entrez GeneMAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer taacaactccgccccatt
- 3′ sequencing primer tccagctcgaccaggatgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mSin1.1 was amplified from HEK293 cDNA library
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N1-mSin1.1-GFP was a gift from Ivan Yudushkin (Addgene plasmid # 72907 ; http://n2t.net/addgene:72907 ; RRID:Addgene_72907) -
For your References section:
Localization of mTORC2 activity inside cells. Ebner M, Sinkovics B, Szczygiel M, Ribeiro DW, Yudushkin I. J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060. 10.1083/jcb.201610060 PubMed 28143890