Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

tetO-FUW-eGFP-RHOA-Q63L
(Plasmid #73081)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73081 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW
  • Backbone manufacturer
    homemade
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RHOA-Q63L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    582
  • Mutation
    Q63L Constitutively active
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
  • Tag / Fusion Protein
    • eGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GTGCCCACAGTGTTTGAGAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pcDNA3-EGFP-RhoA-T19N (#12967). This vector came from the Scripps Research Institute via Addgene.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tetO-FUW-eGFP-RHOA-Q63L was a gift from Andrew Putnam (Addgene plasmid # 73081 ; http://n2t.net/addgene:73081 ; RRID:Addgene_73081)
  • For your References section:

    Matrix identity and tractional forces influence indirect cardiac reprogramming. Kong YP, Carrion B, Singh RK, Putnam AJ. Sci Rep. 2013 Dec 11;3:3474. doi: 10.1038/srep03474. 10.1038/srep03474 PubMed 24326998