-
PurposeLentiviral transfer vector for tet-inducible expression of EGFP tagged human RHOA-Q63L
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUW
-
Backbone manufacturerhomemade
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRHOA-Q63L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)582
-
MutationQ63L Constitutively active
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GTGCCCACAGTGTTTGAGAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypcDNA3-EGFP-RhoA-T19N (#12967). This vector came from the Scripps Research Institute via Addgene.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tetO-FUW-eGFP-RHOA-Q63L was a gift from Andrew Putnam (Addgene plasmid # 73081 ; http://n2t.net/addgene:73081 ; RRID:Addgene_73081) -
For your References section:
Matrix identity and tractional forces influence indirect cardiac reprogramming. Kong YP, Carrion B, Singh RK, Putnam AJ. Sci Rep. 2013 Dec 11;3:3474. doi: 10.1038/srep03474. 10.1038/srep03474 PubMed 24326998