Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3.1-kappa-HA-dL5-BKa
(Plasmid #73212)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73212 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5626
  • Total vector size (bp) 9889
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BKalpha
  • Alt name
    Slo1
  • Alt name
    MaxiK
  • Alt name
    BKalpha
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4263
  • Entrez Gene
    Kcnma1 (a.k.a. 5730414M22Rik, BKC, BKCA alpha, BKCa, KCa1.1, Max, MaxiK, Slo, Slo1, k(VCA)alpha, mSlo, mSlo1, slo-alpha)
  • Promoter CMV
  • Tag / Fusion Protein
    • dL5** (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MfeI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    BKalpha gene was received from Sonal Shruti & Alison Barth; gene was originally synthesized. Carnegie Mellon University
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

MfeI site was destroyed in cloning, but 3' ClaI site is useable for further subcloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-kappa-HA-dL5-BKa was a gift from Marcel Bruchez (Addgene plasmid # 73212 ; http://n2t.net/addgene:73212 ; RRID:Addgene_73212)
  • For your References section:

    Fluorogenic Green-Inside Red-Outside (GIRO) Labeling Approach Reveals Adenylyl Cyclase-Dependent Control of BKalpha Surface Expression. Pratt CP, He J, Wang Y, Barth AL, Bruchez MP. Bioconjug Chem. 2015 Sep 16;26(9):1963-71. doi: 10.1021/acs.bioconjchem.5b00409. Epub 2015 Sep 2. 10.1021/acs.bioconjchem.5b00409 PubMed 26301573