pDD315 (mTurquoise2^SEC^2xHA)
(Plasmid #73343)

• Purpose: mTurquoise2^SEC^2xHA vector with ccdB sites for cloning homology arms
• Depositing Lab: Bob Goldstein
• Publication: Zhang et al J Cell Biol. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. Epub 2023 Jun 23.

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2600
• Total vector size (bp): 10500
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Turbo
• Growth instructions: The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mTurquoise2-C1^SEC^3xFlag
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 6600
• Tags / Fusion Proteins:
  • C. elegans codon-optimized mTurquoise2
  • 2xHA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pDD315 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015). It has a 2xHA tag in place of 3xFlag, and Lox511I sites in place of LoxP. These features allow pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between epitope tags and Lox sites.