pVP2A-PIF6
(Plasmid #73369)

• Purpose: Expresses Adeno-associated virus VP2 with PIF6 insert.
• Depositing Lab: Junghae Suh
• Publication: Gomez et al ACS Nano. 2015 Nov 30.

Backbone

• Vector backbone: pRepCap
• Backbone size w/o insert (bp): 7282
• Total vector size (bp): 7582
• Modifications to backbone: Start codons for VP1 and VP3 have been mutated out.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PIF6
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 300
• Entrez Gene: PIL2 (a.k.a. AT3G62090, PHYTOCHROME-INTERACTING FACTOR 6, PIF6, phytochrome interacting factor 3-like 2)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EagI (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: gttgaggaacctgttaagatg
• 3′ sequencing primer: ggagagtgctctaccggcctc

Resource Information

• Supplemental Documents:
  • plasmid map in genebank format
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are some discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.