Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73432)


Item Catalog # Description Quantity Price (USD)
Plasmid 73432 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Luciano Marraffini (Addgene plasmid # 46569)
  • Backbone size w/o insert (bp) 9296
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    Repressor 5F5 (orthogonal T7-lac repressor)
  • gRNA/shRNA sequence
  • Species
  • Promoter Constitutive wild-type S. pyogenes promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer dCas9-F3 (CACGCATTGATTTGAGTCAGC)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Also encodes dCas9 and tracrRNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdCas9-M-5F5 was a gift from Mattheos Koffas (Addgene plasmid # 73432 ; ; RRID:Addgene_73432)
  • For your References section:

    Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Cress BF, Jones JA, Kim DC, Leitz QD, Englaender JA, Collins SM, Linhardt RJ, Koffas MA. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. 10.1093/nar/gkw231 PubMed 27079979