This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73525)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 73525 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 42230)
  • Backbone size w/o insert (bp) 8506
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-sgRNA_Dgcr8_1 was a gift from Constance Ciaudo (Addgene plasmid # 73525 ; ; RRID:Addgene_73525)
  • For your References section:

    Noncanonical function of DGCR8 controls mESC exit from pluripotency. Cirera-Salinas D, Yu J, Bodak M, Ngondo RP, Herbert KM, Ciaudo C. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. 10.1083/jcb.201606073 PubMed 28100686