pTriEx-mCherry-LINXb3
(Plasmid
#73615)
-
PurposeLight-induced nuclear export switch for microscopy in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 73615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5940
- Total vector size (bp) 6864
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLINXb3
-
SpeciesSynthetic; Avena Sativa
-
Insert Size (bp)924
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCCAACACAATATATTATAGTTAAATAAGAATTATTATC
- 3′ sequencing primer GGTGGTGCTCGAGATCCTCGGGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEx-mCherry-LINXb3 was a gift from Brian Kuhlman (Addgene plasmid # 73615 ; http://n2t.net/addgene:73615 ; RRID:Addgene_73615) -
For your References section:
Light-induced nuclear export reveals rapid dynamics of epigenetic modifications. Yumerefendi H, Lerner AM, Zimmerman SP, Hahn K, Bear JE, Strahl BD, Kuhlman B. Nat Chem Biol. 2016 Jun;12(6):399-401. doi: 10.1038/nchembio.2068. Epub 2016 Apr 18. 10.1038/nchembio.2068 PubMed 27089030