Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73939)


Item Catalog # Description Quantity Price (USD)
Plasmid 73939 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pcDNA3.1 (-)
  • Backbone size w/o insert (bp) 5359
  • Total vector size (bp) 6622
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nls-Flamindo2 was a gift from Tetsuya Kitaguchi (Addgene plasmid # 73939 ; ; RRID:Addgene_73939)
  • For your References section:

    Genetically-encoded yellow fluorescent cAMP indicator with an expanded dynamic range for dual-color imaging. Odaka H, Arai S, Inoue T, Kitaguchi T. PLoS One. 2014 Jun 24;9(6):e100252. doi: 10.1371/journal.pone.0100252. eCollection 2014. PONE-D-14-08126 [pii] PubMed 24959857