pBF_HsPepT2
(Plasmid
#73944)
-
PurposeXenopus oocyte expression vector containing the cDNA of human PepT2 with a c terminal flag tag
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBF
- Backbone size w/o insert (bp) 3003
- Total vector size (bp) 5300
-
Vector typemake RNA for Xenopus oocyte injection
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePepT2
-
Alt nameSLC15A2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2187
-
Entrez GeneSLC15A2 (a.k.a. PEPT2)
- Promoter beta globin
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer TTGTTCTTTTTGCAGAAGC
- 3′ sequencing primer GCTTAGAGACTCCATTCGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBF_HsPepT2 was a gift from Simon Newstead (Addgene plasmid # 73944 ; http://n2t.net/addgene:73944 ; RRID:Addgene_73944) -
For your References section:
Crystal Structures of the Extracellular Domain from PepT1 and PepT2 Provide Novel Insights into Mammalian Peptide Transport. Beale JH, Parker JL, Samsudin F, Barrett AL, Senan A, Bird LE, Scott D, Owens RJ, Sansom MS, Tucker SJ, Meredith D, Fowler PW, Newstead S. Structure. 2015 Oct 6;23(10):1889-99. doi: 10.1016/j.str.2015.07.016. Epub 2015 Aug 27. 10.1016/j.str.2015.07.016 PubMed 26320580