Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #73944)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 73944 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3003
  • Total vector size (bp) 5300
  • Vector type
    make RNA for Xenopus oocyte injection

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SLC15A2 (a.k.a. PEPT2)
  • Promoter beta globin
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHi (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer TTGTTCTTTTTGCAGAAGC
  • 3′ sequencing primer GCTTAGAGACTCCATTCGGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBF_HsPepT2 was a gift from Simon Newstead (Addgene plasmid # 73944 ; ; RRID:Addgene_73944)
  • For your References section:

    Crystal Structures of the Extracellular Domain from PepT1 and PepT2 Provide Novel Insights into Mammalian Peptide Transport. Beale JH, Parker JL, Samsudin F, Barrett AL, Senan A, Bird LE, Scott D, Owens RJ, Sansom MS, Tucker SJ, Meredith D, Fowler PW, Newstead S. Structure. 2015 Oct 6;23(10):1889-99. doi: 10.1016/j.str.2015.07.016. Epub 2015 Aug 27. 10.1016/j.str.2015.07.016 PubMed 26320580