psiCHECK2-let-7 8x
(Plasmid #20931)

• Depositing Lab: Yukihide Tomari
• Publication: Iwasaki et al Mol Cell. 2009 Mar 4. ():.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	20931	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: psiCHECK-2
  (Search Vector Database)
• Backbone manufacturer: promega
• Backbone size w/o insert (bp): 6273
• Vector type: Mammalian Expression, Insect Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 8x let-7 target sites
• Insert Size (bp): 216

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TAAGTACATCAAGAGCTTCG

Resource Information

• Terms and Licenses:
  • UBMTA
  • Luciferase Limited Use Label License
• Articles Citing this Plasmid:
  • 3 References

Depositor Comments

Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG