Holiday Schedule: Addgene will be closed December 23rd & 26th and December 30th & January 2nd. For details, see our holiday shipping schedule. If you have any questions, please contact us at help@addgene.org.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

psiCHECK2-IRES-let-7 8x
(Plasmid #20932)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20932 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    promega
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    8x let-7 target sites
  • Insert Size (bp)
    216
  • Mutation
    168bp IRES from 5'UTR of reaper gene in Drosophila was inserted in the 5'UTR of RL.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAAGTACATCAAGAGCTTCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-IRES-let-7 8x was a gift from Yukihide Tomari (Addgene plasmid # 20932)
  • For your References section:

    Drosophila Argonaute1 and Argonaute2 Employ Distinct Mechanisms for Translational Repression. Iwasaki S, Kawamata T, Tomari Y. Mol Cell. 2009 Mar 4. ():. 10.1016/j.molcel.2009.02.010 PubMed 19268617