1
Plasmid 20932: psiCHECK2-IRES-let-7 8x
  • 8x let-7 target sites

  • 216

  • 168bp IRES from 5'UTR of reaper gene in Drosophila was inserted in the 5'UTR of RL.

  • psiCHECK-2
    (Search Vector Database)

  • promega

  • Mammalian Expression, Insect Expression, Luciferase

  • 6273

  • XhoI

  • No

  • NotI

  • No

  • TAAGTACATCAAGAGCTTCG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Yukihide Tomari

  • UBMTA
    Luciferase Limited Use Label License

Comments: 

Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Drosophila Argonaute1 and Argonaute2 Employ Distinct Mechanisms for Translational Repression. Iwasaki et al (Mol Cell. 2009 Mar 4. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20932" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only