Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

psiCHECK2-IRES-let-7 8x
(Plasmid #20932)

Add to Cart
Available to Academic and Nonprofits Only

  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

  • Gene/Insert name
    8x let-7 target sites
  • Insert Size (bp)
  • Mutation
    168bp IRES from 5'UTR of reaper gene in Drosophila was inserted in the 5'UTR of RL.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAAGTACATCAAGAGCTTCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Single let7 site sequence is - 5'-TCGAGACTATACAAGGATCTACCTCAG

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-IRES-let-7 8x was a gift from Yukihide Tomari (Addgene plasmid # 20932)
  • For your References section:

    Drosophila Argonaute1 and Argonaute2 Employ Distinct Mechanisms for Translational Repression. Iwasaki S, Kawamata T, Tomari Y. Mol Cell. 2009 Mar 4. ():. 10.1016/j.molcel.2009.02.010 PubMed 19268617