Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti puro HA-Ubiquitin
(Plasmid #74218)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74218 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 74218-LV Virus (1 mL at titer > 1x10⁶ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti puro
  • Backbone manufacturer
    synthesized combination of lentiviral elements in pUC19
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ubiquitin
  • Alt name
    UBB
  • Alt name
    Ubiquitin B
  • Species
    H. sapiens (human)
  • Mutation
    Single ubiquitin coding sequence (full length UBB has three repeating ubiquitin coding sequences)
  • GenBank ID
  • Entrez Gene
    UBB (a.k.a. HEL-S-50)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F
  • (Common Sequencing Primers)

Resource Information

Information for Lentiviral Prep (Catalog # 74218-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from pLenti puro HA-Ubiquitin (#74218). In addition to the viral particles, you will also receive purified pLenti puro HA-Ubiquitin plasmid DNA.

Delivery

  • Volume 1 mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 74218-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting the puromycin-resistance gene and the SV40 polyA. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: Puro-F2 CTCGGCTTCACCGTCACC
    Reverse Primer: SV40pA-R GAAATTTGTGATGCTATTGC

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti puro HA-Ubiquitin was a gift from Melina Fan (Addgene plasmid # 74218)